Zastanawiasz się, jak wydać pracę doktorską, habilitacyjną lub monografie? Chcesz dokonać zmian w stylistyce i interpunkcji tekstu naukowego? Nic prostszego! Zaufaj Wydawnictwu Borgis - wydawcy renomowanych książek i czasopism medycznych. Zapewniamy przede wszystkim profesjonalne wsparcie w przygotowaniu pracy, opracowanie dokumentacji oraz druk pracy doktorskiej, magisterskiej, habilitacyjnej. Dzięki nam nie będziesz musiał zajmować się projektowaniem okładki oraz typografią książki.

Poniżej zamieściliśmy fragment artykułu. Informacja nt. dostępu do pełnej treści artykułu tutaj
© Borgis - Nowa Pediatria 4/2018, s. 145-148 | DOI: 10.25121/NP.2018.22.4.145
*Anna Adamowicz-Salach1, Beata Burzyńska2, Alicja Siwicka1, Katarzyna Smalisz1, Michał Matysiak1
Nietypowy obraz hemoglobinopatii współistniejącej z talasemią β
Atypical clinical falieure of hemoglobinopathy in association with thalasemia β
1Katedra i Klinika Pediatrii, Hematologii i Onkologii, Warszawski Uniwersytet Medyczny
Kierownik Kliniki: prof. dr hab. n. med. Michał Matysiak
2Zakład Genetyki, Instytut Biochemii i Biofizyki, Polska Akademia Nauk, Warszawa
Kierownik Zakładu: prof. dr hab. n. med. Teresa Żołądek
Summary
Introduction. Inherited hemoglobin disorders, including thalassemia and hemoglobinopathies, are frequently occurring diseases in the world. Thalassemias are autosomal recessive disorders of hemoglobin synthesis. Underlying molecular defects in the α-globin or β-globin gene clusters form the basis of defective hemoglobin synthesis and the various inherited forms of α- halasemias or β-thalasemias. Thalassemia is diagnosted where hemoglobin levels, volume of red blood cells (MCV) and mean cellular hemoglobin (MCH) are significantly reduced.
Aim. We want to introduce atypical clinical falieure of hemoglobinopathy.
Material and methods. We presented two children with anemia. In first case it was a boy with normal MCV and reduced MCH, next case it was a girl after splenectomy with increased MCV and MCH. In both cases the red cells were hypochromic and also target cells were present in peripheral blood smear. Hemoglobin electrophoresis, measurement of HbA2 and HbF levels were performed.
Results. Test results were characteristic for thalasemia β. Extending the diagnostic panel with genetic tests helped to identify in both of children thalassemia α silience carrier (-α/αα). In first case unstabile hemoglobin Hb Köln (Codon 98(295G > A)) was also detected and in second unstabile hemoglobin Hb Bruxelles (deletions del 42/β+).
Conclusion. Only the genetic tests made it possible to explain atypical blood smear for thalassemia.
Key words: thalasemia α, thalasemia β, unstabile hemoglobin
Wstęp
Talasemie należą do wrodzonych niedokrwistości hemolitycznych, które spowodowane są przez niezrównoważoną syntezę łańcuchów globiny. Zaburzenia w ekspresji globiny mogą dotyczyć każdego z czterech podstawowych łańcuchów – α, β, γ, δ, najczęściej jednak łańcuchów β i α. W zależności od tego, który z łańcuchów syntetyzowany jest w zmniejszonej ilości, możemy rozpoznać talasemię β lub α (1-4). W przypadku talasemii β występują przede wszystkim mutacje punktowe, talasemia α jest zazwyczaj wynikiem delecji genów α globiny, rzadziej występują mutacje punktowe. Mutacje powodujące zaburzenia strukturalne hemoglobiny są określane jako tzw. hemoglobinopatie jakościowe (2). Cechami charakterystycznymi dla talasemii są niedokrwistość mikrocytarna z obniżonym stężeniem hemoglobiny i obniżenie średniego ciężaru hemoglobiny. W rozmazie krwi obwodowej widoczne są krwinki tarczowate, występuje hipochromia i anizocytoza krwinek czerwonych (5-7).
W 2006 roku Zdebska i wsp. opublikowali pracę na temat występowania talasemii na terenie Polski. W badanej grupie pacjentów stwierdzono występowanie nosicielstwa cechy talasemii β i wykryto 7 różnych mutacji śródziemnomorskich, w pojedynczych przypadkach stwierdzono obecność mutacji charakterystycznej dla ludności tatarskiej (8). Znacznie rzadziej wykrywane było nosicielstwo talasemii α, co wiąże się ze znacznie mniejszym rozpowszechnieniem tej postaci choroby w Europie. Choroba ta występuje głównie w Azji Południowo-Wschodniej (9-11).
Cel pracy
Celem pracy jest przedstawienie dwóch przypadków dzieci z nietypowym obrazem morfologicznym krwi obwodowej w przebiegu hemoglobinopatii.
Materiał i metody
Dwoje pacjentów skierowanych zostało do Kliniki Pediatrii, Hematologii i Onkologii WUM z powodu niedokrwistości hemolitycznej o nieznanej przyczynie. W pierwszym przypadku u chłopca jednorazowo obserwowano wystąpienie przełomu hemolitycznego. Liczba krwinek czerwonych obniżyła się do 3,24 x 1012/l, stężenie hemoglobiny wynosiło 8,4 g/dl, MCV 89,4 fl, liczba retikulocytów była zwiększona i wynosiła 4,3% (ARC 182,75 G/L). W późniejszym okresie morfologia uległa normalizacji, jednak stale obserwowano retikulocytozę. W rozmazie obecne były pojedyncze sferocyty. Na tej podstawie ustalono wstępne rozpoznania – sferocytoza wrodzona. Drugi przypadek dotyczył nastoletniej pacjentki z pierwotnym rozpoznaniem sferocytozy wrodzonej, po splenektomii, u której po zabiegu chirurgicznym nie obserwowano poprawy. W morfologii krwi obwodowej stwierdzano niedokrwistość makrocytarną, liczba krwinek czerwonych była obniżona do 3,1 x 1012/l, stężenie hemoglobiny wynosiło 10,4 g/dl, MCV 101,6 fl, a liczba retikulocytów 7,1% (ARC 220,1 G/L) (tab. 1).
Tab. 1. Wyniki badań dodatkowych przedstawionych pacjentów
NrHb A2 [%]Hb F [%]Badania genetyczneRBC [1012/l]HGB [g/dl]MCV [fl]MCH [pg]Ret. [%]Opis krwinek czerwonych
15,51Codon 98 (295G > A) Hb KÖLN -α3,7/αα4,2510,689,424,84,3Makrocyty, mikrocyty, krwinki tarczowate
24,72,75Del 42/β+3,7/αα 3,110,4101,633,77,1Anizocytoza, poikilocytoza, krwinki tarczowate,
stomatocyty, akantocyty
Metody genetyczne
Izolowanie DNA i sekwencjonowanie
DNA izolowano z krwi pobieranej do probówek zawierających EDTA. DNA wyizolowano przy wykorzystaniu zestawu QIAamp DNA Blood Mini Kit (Qiagen, Niemcy).
Łańcuchowa reakcja polimerazy (ang. polymerase chain reaction – PCR) została wykorzystana do amplifikacji genu kodującego beta-globinę. PCR wykonano przy użyciu FastStart PCR System (Roche, Niemcy), zgodnie z zaleceniami producenta. Każda mieszanina reakcyjna zawierała 1-100 lub 10-250 ng DNA, 2,5 μl 10 × PCR bufor, 1,0 μl odpowiednich starterów Startera oraz 1 jednostkę enzymu (FastStart Taq DNA Polymerase) w końcowej objętości 25 μl. PCR przeprowadzano na aparacie Mastercycler personal (Eppendorf, Niemcy), stosując następujące warunki: 2-minutową wstępną denaturację w 94°C, a następnie 30 cykli 45 s w 94°C, 45 s w 59°C, 45 s w 72°C oraz końcowe wydłużanie w 72°C przez 5 minut. Do namnażania eksonu 1 i 2 genu beta-globiny użyto następujące startery: F15’AGTGATGGCCTGGCTCACCT3’ i 1R 5’CCTGAGACTTCCACACTGAT 3’, a dla eksonu 3 startery: F2 5’AGCAGCTACAATCCAGCTAC3’ i 5AGTGGAGTCAAGGCTGAGAG3’. Produkty PCR analizowano metodą elektroforezy agarozowej, a następnie zsekwencjonowane na aparacie ABI Prism 377 (Apllied Biosystem, USA).

Powyżej zamieściliśmy fragment artykułu, do którego możesz uzyskać pełny dostęp.

Płatny dostęp

Aby uzyskać płatny dostęp do pełnej treści powyższego artykułu oraz innych artykułów Czytelni, należy wprowadzić kod:

Kod mogą Państwo uzyskać, przechodząc na tę stronę.
Wprowadzając kod, akceptują Państwo treść Regulaminu oraz potwierdzają zapoznanie się z nim.

Piśmiennictwo
1. Olivieri NF, Weatherall DJ: Clinical aspects of β thalassemia. [In:] Steinberg MH, Forget BG, Higgs DR, Nagel RL (eds.): Disorders of hemoglobin: genetics, pathophysiology and clinical management. Cambridge University Press, Cambridge 2001: 277-341.
2. Taher AT, Weatherall DJ, Cappellini MD: Thalassaemia. Lancet 2018; 391: 155-167.
3. Adamowicz-Salach A: Wrodzone i nabyte niedokrwistości mikrocytarne u dzieci. Onkol Dypl 2017; 15(4): 28-33.
4. Adamowicz-Salach A: Wrodzone niedokrwistości hemolityczne – od rozpoznania do leczenia. Onkol Dypl 2015; 12(5): 20-25.
5. Forget BG: The β thalassemias. [In:] Steinberg MH, Forget BG, Higgs DR, Nagel RL (eds.): Disorders of hemoglobin: genetics, pathophysiology and clinical management. Cambridge University Press, Cambridge 2001: 231-232.
6. Higgs DR, Bowden DK: Clinical and laboratory features of the α-thalassemia syndromes. [In:] Steinberg MH, Forget BG, Higgs DR, Nagel RL (eds.): Disorders of hemoglobin: genetics, pathophysiology and clinical management. Cambridge University Press, Cambridge 2001: 431-469.
7. Bianco I, Cappabianca MP, Foglietta E et al.: Silent Thalassemias: Genotypes and Phenotypes. Haematologica 1997; 82: 269-280.
8. Zdebska E, Krawcewicz A, Adamowicz-Salach A et al.: β-thalassemia w Polsce. I. Mutacje śródziemnomorskie. Pol Merk Lek 2006; 115: 53-56.
9. Bernini LF: Geographical distribution of α thalassemia. [In:] Steinberg MH, Forget BG, Higgs DR, Nagel RL (eds.): Disorders of hemoglobin: genetics, pathophysiology and clinical management. Cambridge University Press, Cambridge 2001: 527-531.
10. Koza K, Łoniewska-Lwowska A, Fabijańska-Mitek J et al.: Molecular diagnostics of thalassemia α in Polish population. Post Nauk Med 2016; XXIX(2): 88-91.
11. Maciąg M, Płochocka D, Adamowicz-Salach A: Diversity of thalassemia. Acta Haematol 2014; 99(5): 811-820.
12. Liu YT, Old JM, Miles K et al.Rapid detection of a-thalassemia deletions and a-globin gene triplication by multiplex polymerase chain reactions Brit J Haematol 2000;108:295-299.
13. Phyliky RL, Fairbanks VF: Thromboembolic complication of splenectomy in unstable hemoglobin disorders: Hb Olmsted, Hb Holn. Am J Hematol 1997; 55(1): 53.
14. Landin B, Fröstad B, Brune M, Ljung R: Haemoglobin Köln as de Novo mutations in Sweden: diagnosis by PCR and specific enzymatic cleavage. Eur J Haematol 1994; 52(3): 156-161.
15. Griffon N, Badens C, Lena-Russo D et al.: Hb Bruxelles, deletion of Phebeta42, shows a low oxygen affinity and low cooperativity of ligand binding. J Biol Chem 1996; 271(42): 25916-25920.
16. Adamowicz-Salach A, Zdebska E, Burzyńska B et al.: Talasemia alfa przyczyną niedokrwistości mikrocytarnej w Polsce – opis przypadków. Ped Pol 2007; 82: 151-155.
17. Piel FB, Weatherall DJ: The α-Thalassemias. N Engl J Med 2014; 371: 1908-1916.
18. Tatu T, Kiewkarnkha T, Khuntarak S et al.: Screening for co-existence of α-thalassemia and in HbE heterozygotes via an enzyme-linked immunosorbent assay for Hb Bart’s and embryonic ζ-globin chain. Int J Hematol 2012; 95: 386-393.
19. Wee YC, Tan KL, Kuldpi K et al.: Alpha-Thalassaemia in Association with Beta-Thalassaemia Patients in Malaysia: A Study on the Co-Inheritance of Both Disorders. Community Genet 2008; 11: 129-134.
otrzymano: 2018-11-06
zaakceptowano do druku: 2018-12-05

Adres do korespondencji:
*Anna Adamowicz-Salach
Klinika Pediatrii, Hematologii i Onkologii Warszawski Uniwersytet Medyczny
ul. Żwirki i Wigury 63a, 02-091 Warszawa
tel.: +48 (22) 317-96-16
anna.adamowicz-salach@wum.edu.pl

Nowa Pediatria 4/2018
Strona internetowa czasopisma Nowa Pediatria