Zastanawiasz się, jak wydać pracę doktorską, habilitacyjną lub monografie? Chcesz dokonać zmian w stylistyce i interpunkcji tekstu naukowego? Nic prostszego! Zaufaj Wydawnictwu Borgis - wydawcy renomowanych książek i czasopism medycznych. Zapewniamy przede wszystkim profesjonalne wsparcie w przygotowaniu pracy, opracowanie dokumentacji oraz druk pracy doktorskiej, magisterskiej, habilitacyjnej. Dzięki nam nie będziesz musiał zajmować się projektowaniem okładki oraz typografią książki.

Poniżej zamieściliśmy fragment artykułu. Informacja nt. dostępu do pełnej treści artykułu tutaj
© Borgis - Postępy Nauk Medycznych 12/2012, s. 981-985
*Izabela Korczowska1, Dorota Trzybulska1, Lidia Ostanek2, Marek Brzosko2, Marta Rosińska1, Zofia Niemir3, Paweł Hrycaj1
Występowanie polimorfizmu C1q (rs292001) u chorych na toczeń rumieniowaty układowy**
Polymorphism of C1q complement (rs292001) occurrence in systemic lupus erythematosus patients
1Zakład Reumatologii i Immunologii Klinicznej, Uniwersytet Medyczny w Poznaniu
Kierownik Zakładu: dr hab. med. Paweł Hrycaj, prof. UM
2Klinika Reumatologii i Chorób Wewnętrznych, Pomorski Uniwersytet Medyczny w Szczecinie
Kierownik Kliniki: prof. dr hab. med. Marek Brzosko
3Pracownia Nefrologii Molekularnej, Uniwersytet Medyczny w Poznaniu
Kierownik Pracowni: prof. dr hab. med. Zofia Niemir
Streszczenie
Wstęp. Toczeń rumieniowaty układowy (TRU) jest przewlekłą, autoimmunologiczną chorobą, w której dochodzi do uszkodzenia wielu narządów. Nie ustalono do tej pory bezpośredniej przyczyny choroby. Uważa się, że na jej rozwój mają wpływ m.in. predyspozycje genetyczne, które prowadzą do obniżenia składowych układu dopełniacza, takich jak C1q, C2, C3, C4. Deficyt C1q dopełniacza prawdopodobnie jest najsilniejszym czynnikiem ryzyka TRU (OR prawie 10). Liczne badania sugerują udział różnych genów w patogenezie TRU, kilkanaście doniesień dotyczy polimorfizmu genu składowej C1q. Żadna z tych publikacji nie opisuje ryzyka rozwoju TRU obejmującego polimorfizm C1q rs292001 w populacji polskiej.
Cel pracy. Celem badania było określenie częstości występowania polimorfizmu genu składowej C1Q dopełniacza (rs292001) w polskiej populacji chorych na toczeń rumieniowaty układowy oraz u zdrowych osób.
Materiał i metody. Grupa chorych obejmowała 98 nie spokrewnionych chorych na TRU, grupę kontrolną stanowiło 101 zdrowych osób. Materiałem do badań genetycznych było DNA wyizolowane z leukocytów krwi obwodowej metodą wysalania. Genotypowanie wykonano przy użyciu metody Tetra-Primer ARMS PCR.
Wyniki. W przeprowadzonych badaniach nie znaleziono statystycznie istotnych zależności wskazujących na powiązanie polimorfizmu składowej C1q (rs292001) z występowaniem TRU.
Wnioski. Brak różnic w częstości występowania polimorfizmu składowej C1q rs292001 między badaną grupą chorych na TRU a grupą kontrolną może świadczyć o braku wpływu tego polimorfizmu na rozwój TRU w polskiej populacji, jak również o dużej różnorodności czynników genetycznych zaangażowanych w patogenezę choroby.
Summary
Introduction. Systemic lupus erythematosus (SLE) is a chronic, autoimmunological disease. The cause of disease is still unknown. It may be assumed that genetic predisposition can predispose to development of disease. Patient who suffer from SLE manifest decreased complement component C1q, C2, C3 and C4. It seems that decreased of C1q is the most important risk to development o SLE (OR almost 10).
Aim. We aimed to identify associations between common C1q rs292001 polymorphisms and SLE risk in polish population
Material and methods. We analyzed ninety-eight patients with established diagnosis of SLE and 101 healthy individuals in the control group. Biological material used in the studies was DNA. The method of salting out was used to obtain the DNA and genotyped using Tetra-Primer ARM PCR methods.
Results. Statistical analysis revealed that there were no significant associations observed in the genotype distributions and allele frequencies among the patients with SLE and healthy control subjects.
Conclusions. There was no evidence for a significant role of C1q locus gene polymorphisms in SLE risk predisposition in polish population.
WSTĘP
Toczeń rumieniowaty układowy (TRU) jest przewlekłą, autoimmunologiczną chorobą, w której dochodzi do uszkodzenia wielu narządów. Nie ustalono do tej pory bezpośredniej przyczyny choroby. Uważa się, że na jej rozwój mają wpływ predyspozycje genetyczne, zaburzenia immunologiczne, wpływ środowiska zewnętrznego czy zaburzenia hormonalne. Za podejrzeniem tła genetycznego choroby przemawiają obserwacje kliniczne potwierdzające rodzinne występowanie TRU. U chorych z rozpoznanym TRU stwierdza się defekty genetyczne, które prowadzą do obniżenia składowych układu dopełniacza, takich jak C1q, C2, C3, C4. Centralnym punktem rozwoju reakcji zapalnych jest układ dopełniacza, którego główną funkcją jest chemotaksja (opsonizacja i aktywacja komórek, zapoczątkowanie reakcji nabytej oraz liza komórek docelowych). Zmniejszone stężenie w surowicy składników dopełniacza może prowadzić do gromadzenia się w komórkach ciałek apoptotycznych, nadmiaru kompleksów immunologicznych i rozwoju licznych stanów zapalnych (1). Do zaburzeń immunologicznych występujących w przebiegu choroby zaliczyć możemy obecność przeciwciał przeciw dsDNA (przeciwciała przeciw dwuniciowemu DNA), obecność przeciwciał przeciw Sm (anty-Smith), obecność przeciwciał antyfosfolipidowych oraz obecność przeciwciał przeciwjądrowych (ang. anti-nuclear antibodies – ANA) w mianie uznanym za nieprawidłowe.
Składowa C1q należy do klasycznej drogi aktywacji dopełniacza, jej upośledzenie zaburza fagocytozę kompleksów immunologicznych (2, 3, 4), które pozostając w krążeniu mogą powodować lub nasilać autoagresję. Geny kodujące składową C1q dopełniacza znajdują się w regionie 1p34-36. Dziedziczony niedobór C1q dopełniacza występuje u chorych na TRU i jest dowodem na znaczenie tej składowej dopełniacza w patogenezie reakcji autoimmunizacji skierowanej przeciwko strukturom jądra komórkowego. Składowa C1q dopełniacza wraz z DNAzą I degradują chromatynę pochodzącą z komórek, które ulegają martwicy. Deficyt C1q dopełniacza prawdopodobnie jest najsilniejszym czynnikiem ryzyka TRU (OR prawie 10) (5, 6), podobnie jak. choć w nieco mniejszym stopniu niedobór składnika C2 (OR ok. 4,5) (7) oraz C4A i C4B (OR ok. 1,5-5) (8). Martens HA i wsp. (9) nie stwierdzili wpływu polimorfizmu genu C1q rs292001 na stężenie C1q w grupie chorych na TRU, podczas gdy Racilla i wsp. taką zależność wykazali (10). Liczne badania sugerują udział różnych genów w patogenezie TRU, kilkanaście doniesień dotyczy polimorfizmu genu składowej C1q, żadna z tych prac nie opisuje ryzyka rozwoju TRU obejmującego polimorfizmu C1q rs292001 w populacji polskiej.
Cel pracy
Celem badania było określenie częstości występowania polimorfizmu genu składowej C1q dopełniacza (rs292001) w polskiej populacji chorych na toczeń rumieniowaty układowy oraz u zdrowych osób.
Materiał i Metody
Badanie uzyskało zgodę Komisji ds. Etyki i Badań Naukowych przy Uniwersytecie im. Karola Marcinkowskiego w Poznaniu. Wszystkie osoby biorące udział w badaniu zostały poinformowane o założeniach badania oraz jego przebiegu i wyrazili świadomą pisemną zgodę na udział w badaniach.
Grupę kontrolną stanowiło 101 zdrowych dawców krwi (51 kobiet i 50 mężczyzn), kobiety w wieku 19-43 lata oraz mężczyźni w wieku 19-51 lat. Kryteriami wykluczającymi w tym badaniu były choroby autoimmunologiczne, nowotwory, niewydolność układu oddechowego, układu krążenia, nerek, wątroby, ostre i przewlekłe zakażenia i zapalenia. Grupa chorych obejmowała 98 nie spokrewnionych chorych na TRU, rasy kaukaskiej, pochodzenia polskiego, w wieku od 20 do 70 lat, (60 kobiet i 38 mężczyzn). Rozpoznanie ustalono na podstawie kryteriów klasyfikacji TRU wg ACR (ang. American College of Reumatology) (11). U chorych rozpoznano chorobę, jeżeli zostało spełnione co najmniej 4 z 11 kryteriów w chwili badania lub w wywiadzie. Każdy chory został poddany szczegółowej ocenie klinicznej obejmującej badanie podstawowe i przedmiotowe. Stopień aktywności TRU, określono na podstawie skali aktywności tocznia rumieniowatego układowego (systemic lupus erythrodermatosus activity index – SLEDAI) (12). Niską aktywność choroby stwierdzono u 53% pacjentów, u 34% pacjentów średnią, a u 13% wysoką aktywność choroby. We krwi pacjentów oznaczono metodą immunofluorescencji pośredniej miano przeciwciał przeciwjądrowych oraz zbadano metodą Euroline (Euroimmun, Niemcy) obecność przeciwciał przeciwko rozpuszczalnym antygenom jądra komórkowego. Materiałem do badań genetycznych było DNA wyizolowane z leukocytów krwi żylnej pobranej do probówek zawierających 10% EDTA. DNA zostało wyizolowane z leukocytów krwi obwodowej metodą wysalania. Genotypowanie wykonano przy użyciu metody tetra-primer ARMS PCR (łańcuchowa reakcja polimerazy). Metoda ta została wykorzystana ze względu na brak możliwości dobrania enzymu rozpoznającego analizowane miejsce polimorficzne. W reakcji tetra-primer ARMS PCR użyto następujących starterów:
Forward inner (G allele):
AGACCAGAAGGATCACATAGACATTTGAAG
Reverse inner (A allele):
ATGTAGGATGCCCGGATGCAAATGAT
Forward outer (5’-3’):
CTCTGAGCCTAAGTGGGCTCATCTGTAA
Reverse outer (5’-3’):
AAGTGGAGAGAAGTGTGAACAGGCACTT
Na poszczególnych etapach warunki reakcji przedstawiały się następująco: denaturacja wstępna przez 3 min w temperaturze 95°C, namnażanie produktu reakcji (35 cykli): 30 s w temperaturze 95°C, 30 s w temperaturze 65,9°C oraz 30 s w temperaturze 72°C, faza końcowej syntezy produktu reakcji odbywała się przez 10 min w temperaturze 72°C. Reakcje PCR przeprowadzono na termocyklerze Mastercycler ep firmy Eppendorf. Produkt analizy został rozdzielony na 2% żelu agarozowym.
Analizę rozkładu częstości genotypów przeprowadzono za pomocą pakietu statystycznego Statistica 7.1., stosując test zgodności chi-kwadrat Pearsona, a analizę rozkładu częstości alleli – z wykorzystaniem testu dokładnego prawdopodobieństwa Fishera. Dla analiz przyjęto jako istotny statystycznie poziom istotności p < 0,05. W przypadku grup o liczebności mniejszej niż 5 zastosowano test dokładnego prawdopodobieństwa Fishera – Frimana – Haltona. Stwierdzono, że prawo Hardy’ego-Weinberga dla badanych alleli zostało zachowane.
Wyniki
W badanej grupie chorych przeciwciała typu ANA wykryto u 60 chorych, przeciw dsDNA u 27 chorych, natomiast przeciwciała przeciw nukleosomom były obecne u 26 pacjentów. Przeciwciała anty-Sm stwierdzono tylko u 3 chorych, przeciw-SSA (ang. Sjögren’s antibodies) u 31 chorych, natomiast przeciwciała anty-SSB (ang. Sjögren’s antibodies) były obecne u 13 pacjentów. Przeciwciała przeciw RNP (ang. Ribonucleoprotein antibodies) wystąpiły u 13 chorych, przeciwciała przeciw histonom u 10 pacjentów, przeciwciała przeciw rybosomalnemu białku P pojawiły się u 4 osób z toczniem rumieniowatym układowym.

Powyżej zamieściliśmy fragment artykułu, do którego możesz uzyskać pełny dostęp.

Płatny dostęp

Aby uzyskać płatny dostęp do pełnej treści powyższego artykułu oraz innych artykułów Czytelni, należy wprowadzić kod:

Kod (cena 20 zł za 30 dni dostępu) mogą Państwo uzyskać, przechodząc na tę stronę.
Wprowadzając kod, akceptują Państwo treść Regulaminu oraz potwierdzają zapoznanie się z nim.

Piśmiennictwo
1. Jakóbisiak M, Wańkowicz-Kalińska A: Zjawiska Autoimmunizacyjne. [W:] Gołąb J, Lasek W (red.): Immunologia. Wydawnictwo Naukowe PWN, Warszawa 2008; 376-397.
2. Botto M, Wlaport MJ: C1q, autoimmunity and apoptosis. Immunobiology 2002; 205: 395-406.
3. Walport MJ, Davies KA, Botto M: C1q and systemic lupus erythematosus. Immunobiology 1998; 199: 265-285.
4. Walport MJ: Complement. Second of two parts. N Eng J Med 2001; 12; 344: 1140-1144.
5. Morgan BP, Walport MJ: Complement deficienty and disease. Immunol Today 1991; 12: 301-306.
6. Petry F, Loos M: Common silent mutations in all types of hereditary complement C1q deficiencies. Immunogenetics 2005; 57: 566-571.
7. Sullivan KE, Petri MA, Schmeckpeper BJ et al.: Prevalence of mutation causing C2 deficiency in systemic lupus erythematosus. J Rheumatol 1994; 21: 1128-1133.
8. Reveille JD, Arnett FC, Wilson RW et al.: Null alleles of the fourth component of complement and HLA haplotypes in familial lupus erythematosus. Immunogenetits 1985; 21: 299-311.
9. Martens HA, Zuurman MW, Lange AHM: Analysis of C1q polymorphism suggest association with SLE serum C1q and CH 50 levels and disease severity. Ann Rheum Dis 2009; 68: 715-20.
10. Racila DM, Sontheimer CJ, Sheffield A et al.: Homozygous single nucleotide polymorphism of the complement C1qA gene is associate with decrease levels of C1q in patient with subacute cutaneus lupus erythematosus. Lupus 2003; 12: 124-132.
11. Tan EM, Cohen AS, Fries JF et al.: The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1982; 25(11): 1271-1277.
12. Bombardier C, Gladman DD, Urowitz MB et al.: Derivation of the SLEDAI. A disease activity index for lupus patients. The committee on prognosis studies in SLE. Arthritis Rheum 1992; 35(6): 630-640.
13. Harley JB, Kelly JA, Kaufman KM: Ultraveling the genetics of systemic lupus erythematosus. Springer Semin Immunopathol 2006; 28: 119 -130.
14. Namjou B, Gray-McGuire C, Sestak AL et al.: Evaluation of C1q genomic region in minority racial groups of lupus. Genes Immun 2009; 10: 517-24.
15. Chew H, Chua KH, Lian LH et al.: PCR – RFLP genotyping of C1q mutations and single nukleotide polymorphisms in Malaysian patients with systemic lupus erythematosus. Hum Biol 2008; 80: 83-93.
16. Sontheimer RD, Racila E, Racila DM: C1q: its functions within the innate and adaptive immune responses and its role in lupus autoimmunity. J Invest Dermatol 2005; 125: 14-23.
17. Berkel AI, Birben E, Oner C et al.: Molecular, genetic and epidemiologic studies on selective complete C1q deficienty in Turkey. Immunology 2000; 201: 347-355.
otrzymano: 2012-06-28
zaakceptowano do druku: 2012-08-22

Adres do korespondencji:
*Izabela Korczowska
Zakład Reumatologii i Immunologii Klinicznej Uniwersytet Medyczny w Poznaniu
ul. Przybyszewskiego 39, 60-356 Poznań
tel.: +48 (61) 854-72-10, fax: +48 (61) 854-72-12
e-mail: ikorcz@post.pl

Postępy Nauk Medycznych 12/2012
Strona internetowa czasopisma Postępy Nauk Medycznych