Chcesz wydać pracę doktorską, habilitacyjną czy monografię? Zrób to w Wydawnictwie Borgis – jednym z najbardziej uznanych w Polsce wydawców książek i czasopism medycznych. W ramach współpracy otrzymasz pełne wsparcie w przygotowaniu książki – przede wszystkim korektę, skład, projekt graficzny okładki oraz profesjonalny druk. Wydawnictwo zapewnia szybkie terminy publikacji oraz doskonałą atmosferę współpracy z wysoko wykwalifikowanymi redaktorami, korektorami i specjalistami od składu. Oferuje także tłumaczenia artykułów naukowych, skanowanie materiałów potrzebnych do wydania książki oraz kompletowanie dorobku naukowego.

© Borgis - Postępy Nauk Medycznych 12/2012, s. 981-985
*Izabela Korczowska1, Dorota Trzybulska1, Lidia Ostanek2, Marek Brzosko2, Marta Rosińska1, Zofia Niemir3, Paweł Hrycaj1
Występowanie polimorfizmu C1q (rs292001) u chorych na toczeń rumieniowaty układowy**
Polymorphism of C1q complement (rs292001) occurrence in systemic lupus erythematosus patients
1Zakład Reumatologii i Immunologii Klinicznej, Uniwersytet Medyczny w Poznaniu
Kierownik Zakładu: dr hab. med. Paweł Hrycaj, prof. UM
2Klinika Reumatologii i Chorób Wewnętrznych, Pomorski Uniwersytet Medyczny w Szczecinie
Kierownik Kliniki: prof. dr hab. med. Marek Brzosko
3Pracownia Nefrologii Molekularnej, Uniwersytet Medyczny w Poznaniu
Kierownik Pracowni: prof. dr hab. med. Zofia Niemir
Streszczenie
Wstęp. Toczeń rumieniowaty układowy (TRU) jest przewlekłą, autoimmunologiczną chorobą, w której dochodzi do uszkodzenia wielu narządów. Nie ustalono do tej pory bezpośredniej przyczyny choroby. Uważa się, że na jej rozwój mają wpływ m.in. predyspozycje genetyczne, które prowadzą do obniżenia składowych układu dopełniacza, takich jak C1q, C2, C3, C4. Deficyt C1q dopełniacza prawdopodobnie jest najsilniejszym czynnikiem ryzyka TRU (OR prawie 10). Liczne badania sugerują udział różnych genów w patogenezie TRU, kilkanaście doniesień dotyczy polimorfizmu genu składowej C1q. Żadna z tych publikacji nie opisuje ryzyka rozwoju TRU obejmującego polimorfizm C1q rs292001 w populacji polskiej.
Cel pracy. Celem badania było określenie częstości występowania polimorfizmu genu składowej C1Q dopełniacza (rs292001) w polskiej populacji chorych na toczeń rumieniowaty układowy oraz u zdrowych osób.
Materiał i metody. Grupa chorych obejmowała 98 nie spokrewnionych chorych na TRU, grupę kontrolną stanowiło 101 zdrowych osób. Materiałem do badań genetycznych było DNA wyizolowane z leukocytów krwi obwodowej metodą wysalania. Genotypowanie wykonano przy użyciu metody Tetra-Primer ARMS PCR.
Wyniki. W przeprowadzonych badaniach nie znaleziono statystycznie istotnych zależności wskazujących na powiązanie polimorfizmu składowej C1q (rs292001) z występowaniem TRU.
Wnioski. Brak różnic w częstości występowania polimorfizmu składowej C1q rs292001 między badaną grupą chorych na TRU a grupą kontrolną może świadczyć o braku wpływu tego polimorfizmu na rozwój TRU w polskiej populacji, jak również o dużej różnorodności czynników genetycznych zaangażowanych w patogenezę choroby.
Summary
Introduction. Systemic lupus erythematosus (SLE) is a chronic, autoimmunological disease. The cause of disease is still unknown. It may be assumed that genetic predisposition can predispose to development of disease. Patient who suffer from SLE manifest decreased complement component C1q, C2, C3 and C4. It seems that decreased of C1q is the most important risk to development o SLE (OR almost 10).
Aim. We aimed to identify associations between common C1q rs292001 polymorphisms and SLE risk in polish population
Material and methods. We analyzed ninety-eight patients with established diagnosis of SLE and 101 healthy individuals in the control group. Biological material used in the studies was DNA. The method of salting out was used to obtain the DNA and genotyped using Tetra-Primer ARM PCR methods.
Results. Statistical analysis revealed that there were no significant associations observed in the genotype distributions and allele frequencies among the patients with SLE and healthy control subjects.
Conclusions. There was no evidence for a significant role of C1q locus gene polymorphisms in SLE risk predisposition in polish population.
WSTĘP
Toczeń rumieniowaty układowy (TRU) jest przewlekłą, autoimmunologiczną chorobą, w której dochodzi do uszkodzenia wielu narządów. Nie ustalono do tej pory bezpośredniej przyczyny choroby. Uważa się, że na jej rozwój mają wpływ predyspozycje genetyczne, zaburzenia immunologiczne, wpływ środowiska zewnętrznego czy zaburzenia hormonalne. Za podejrzeniem tła genetycznego choroby przemawiają obserwacje kliniczne potwierdzające rodzinne występowanie TRU. U chorych z rozpoznanym TRU stwierdza się defekty genetyczne, które prowadzą do obniżenia składowych układu dopełniacza, takich jak C1q, C2, C3, C4. Centralnym punktem rozwoju reakcji zapalnych jest układ dopełniacza, którego główną funkcją jest chemotaksja (opsonizacja i aktywacja komórek, zapoczątkowanie reakcji nabytej oraz liza komórek docelowych). Zmniejszone stężenie w surowicy składników dopełniacza może prowadzić do gromadzenia się w komórkach ciałek apoptotycznych, nadmiaru kompleksów immunologicznych i rozwoju licznych stanów zapalnych (1). Do zaburzeń immunologicznych występujących w przebiegu choroby zaliczyć możemy obecność przeciwciał przeciw dsDNA (przeciwciała przeciw dwuniciowemu DNA), obecność przeciwciał przeciw Sm (anty-Smith), obecność przeciwciał antyfosfolipidowych oraz obecność przeciwciał przeciwjądrowych (ang. anti-nuclear antibodies – ANA) w mianie uznanym za nieprawidłowe.
Składowa C1q należy do klasycznej drogi aktywacji dopełniacza, jej upośledzenie zaburza fagocytozę kompleksów immunologicznych (2, 3, 4), które pozostając w krążeniu mogą powodować lub nasilać autoagresję. Geny kodujące składową C1q dopełniacza znajdują się w regionie 1p34-36. Dziedziczony niedobór C1q dopełniacza występuje u chorych na TRU i jest dowodem na znaczenie tej składowej dopełniacza w patogenezie reakcji autoimmunizacji skierowanej przeciwko strukturom jądra komórkowego. Składowa C1q dopełniacza wraz z DNAzą I degradują chromatynę pochodzącą z komórek, które ulegają martwicy. Deficyt C1q dopełniacza prawdopodobnie jest najsilniejszym czynnikiem ryzyka TRU (OR prawie 10) (5, 6), podobnie jak. choć w nieco mniejszym stopniu niedobór składnika C2 (OR ok. 4,5) (7) oraz C4A i C4B (OR ok. 1,5-5) (8). Martens HA i wsp. (9) nie stwierdzili wpływu polimorfizmu genu C1q rs292001 na stężenie C1q w grupie chorych na TRU, podczas gdy Racilla i wsp. taką zależność wykazali (10). Liczne badania sugerują udział różnych genów w patogenezie TRU, kilkanaście doniesień dotyczy polimorfizmu genu składowej C1q, żadna z tych prac nie opisuje ryzyka rozwoju TRU obejmującego polimorfizmu C1q rs292001 w populacji polskiej.
Cel pracy
Celem badania było określenie częstości występowania polimorfizmu genu składowej C1q dopełniacza (rs292001) w polskiej populacji chorych na toczeń rumieniowaty układowy oraz u zdrowych osób.
Materiał i Metody
Badanie uzyskało zgodę Komisji ds. Etyki i Badań Naukowych przy Uniwersytecie im. Karola Marcinkowskiego w Poznaniu. Wszystkie osoby biorące udział w badaniu zostały poinformowane o założeniach badania oraz jego przebiegu i wyrazili świadomą pisemną zgodę na udział w badaniach.
Grupę kontrolną stanowiło 101 zdrowych dawców krwi (51 kobiet i 50 mężczyzn), kobiety w wieku 19-43 lata oraz mężczyźni w wieku 19-51 lat. Kryteriami wykluczającymi w tym badaniu były choroby autoimmunologiczne, nowotwory, niewydolność układu oddechowego, układu krążenia, nerek, wątroby, ostre i przewlekłe zakażenia i zapalenia. Grupa chorych obejmowała 98 nie spokrewnionych chorych na TRU, rasy kaukaskiej, pochodzenia polskiego, w wieku od 20 do 70 lat, (60 kobiet i 38 mężczyzn). Rozpoznanie ustalono na podstawie kryteriów klasyfikacji TRU wg ACR (ang. American College of Reumatology) (11). U chorych rozpoznano chorobę, jeżeli zostało spełnione co najmniej 4 z 11 kryteriów w chwili badania lub w wywiadzie. Każdy chory został poddany szczegółowej ocenie klinicznej obejmującej badanie podstawowe i przedmiotowe. Stopień aktywności TRU, określono na podstawie skali aktywności tocznia rumieniowatego układowego (systemic lupus erythrodermatosus activity index – SLEDAI) (12). Niską aktywność choroby stwierdzono u 53% pacjentów, u 34% pacjentów średnią, a u 13% wysoką aktywność choroby. We krwi pacjentów oznaczono metodą immunofluorescencji pośredniej miano przeciwciał przeciwjądrowych oraz zbadano metodą Euroline (Euroimmun, Niemcy) obecność przeciwciał przeciwko rozpuszczalnym antygenom jądra komórkowego. Materiałem do badań genetycznych było DNA wyizolowane z leukocytów krwi żylnej pobranej do probówek zawierających 10% EDTA. DNA zostało wyizolowane z leukocytów krwi obwodowej metodą wysalania. Genotypowanie wykonano przy użyciu metody tetra-primer ARMS PCR (łańcuchowa reakcja polimerazy). Metoda ta została wykorzystana ze względu na brak możliwości dobrania enzymu rozpoznającego analizowane miejsce polimorficzne. W reakcji tetra-primer ARMS PCR użyto następujących starterów:
Forward inner (G allele):
AGACCAGAAGGATCACATAGACATTTGAAG
Reverse inner (A allele):
ATGTAGGATGCCCGGATGCAAATGAT
Forward outer (5’-3’):
CTCTGAGCCTAAGTGGGCTCATCTGTAA
Reverse outer (5’-3’):
AAGTGGAGAGAAGTGTGAACAGGCACTT
Na poszczególnych etapach warunki reakcji przedstawiały się następująco: denaturacja wstępna przez 3 min w temperaturze 95°C, namnażanie produktu reakcji (35 cykli): 30 s w temperaturze 95°C, 30 s w temperaturze 65,9°C oraz 30 s w temperaturze 72°C, faza końcowej syntezy produktu reakcji odbywała się przez 10 min w temperaturze 72°C. Reakcje PCR przeprowadzono na termocyklerze Mastercycler ep firmy Eppendorf. Produkt analizy został rozdzielony na 2% żelu agarozowym.
Analizę rozkładu częstości genotypów przeprowadzono za pomocą pakietu statystycznego Statistica 7.1., stosując test zgodności chi-kwadrat Pearsona, a analizę rozkładu częstości alleli – z wykorzystaniem testu dokładnego prawdopodobieństwa Fishera. Dla analiz przyjęto jako istotny statystycznie poziom istotności p < 0,05. W przypadku grup o liczebności mniejszej niż 5 zastosowano test dokładnego prawdopodobieństwa Fishera – Frimana – Haltona. Stwierdzono, że prawo Hardy’ego-Weinberga dla badanych alleli zostało zachowane.
Wyniki
W badanej grupie chorych przeciwciała typu ANA wykryto u 60 chorych, przeciw dsDNA u 27 chorych, natomiast przeciwciała przeciw nukleosomom były obecne u 26 pacjentów. Przeciwciała anty-Sm stwierdzono tylko u 3 chorych, przeciw-SSA (ang. Sjögren’s antibodies) u 31 chorych, natomiast przeciwciała anty-SSB (ang. Sjögren’s antibodies) były obecne u 13 pacjentów. Przeciwciała przeciw RNP (ang. Ribonucleoprotein antibodies) wystąpiły u 13 chorych, przeciwciała przeciw histonom u 10 pacjentów, przeciwciała przeciw rybosomalnemu białku P pojawiły się u 4 osób z toczniem rumieniowatym układowym.
W wyniku przeprowadzonej analizy restrykcyjnej produktu reakcji tetra primer ARMS PCR, otrzymano 3 warianty polimorficzne genu C1q (rs292001): homozygotę GG, heterozygotę AG oraz homozygotę AA. W grupie kontrolnej polimorfizm AG stwierdzono u 49 osób, polimorfizm GG u 35 osób, natomiast polimorfizm AA u 17 osób. W badanej grupie chorych polimorfizm AG wystąpił u 55 pacjentów, polimorfizm GG u 32 chorych na TRU, natomiast polimorfizm AA wystąpił u 11 pacjentów. Rozkład poszczególnych genotypów i alleli występujących u pacjentów oraz w zdrowej kontroli zawarte są w tabeli 1.
Tabela 1. Rozkład genotypów w grupie kontrolnej i badanej grupie chorych na TRU.
 GenotypyAllele
GGAGAAGA
Kontrola
(n = 101)
35491711983
Pacjenci
(n = 98)
32551111977
Wysoką aktywność choroby stwierdzono u 14 osób z polimorfizmem GG, u 1 osoby z polimorfizmem AA oraz u 17 pacjentów z polimorfizmem AG. Podwyższone miano przeciwciał typu ANA stwierdzono u 7 osób z polimorfizmem GG, u 3 pacjentów z polimorfizmem AA oraz u 10 osób z polimorfizmem AG. W badanym polimorfizmie genu kodującego C1q (rs292001) rozkład genotypów nie różnił się statystycznie istotnie w grupie pacjentów z niską aktywnością choroby i u chorych na TRU o średniej i wysokiej aktywności (p > 0,05).
W przeprowadzonych badaniach nie znaleziono statystycznie istotnych zależności wskazujących na powiązanie polimorfizmu składowej C1q (rs292001) z występowaniem TRU. Wyniki analizy statystycznej przedstawia tabela 2.
Tabela 2. Allele ryzyka.
Allel ryzyka A Allel ryzyka G
Allel ryzyka G vs. A: iloraz szans OR=0,928
C.I. – (0,621-1,385)
?2 – 0,13
p = 0,71373
brak istotności statystycznej
Allel ryzyka A vs. G: iloraz szans OR = 1,078
CI. – (0,722-1,610)
?2 – 0,13
p = 0,71373
brak istotności statystycznej
Allel ryzyka GG vs. GA: iloraz szans OR = 1,228
CI.– ( 0,664-2,270)
?2 – 0,43
p = 0,51298
brak istotności statystycznej
Allel ryzyka AA vs. GA: iloraz szans OR = 1,735
C.I.– (0,741-4,061)
?2 – 1,63
p = 0,20144
brak istotności statystycznej
Allel ryzyka GG vs. AA: iloraz szans OR = 0,708
C.I. – (0,289-1,736)
?2 – 0,57
p = 0,44925
brak istotności statystycznej
Allel ryzyka AA vs. GG: iloraz szans OR = 1,413
C.I. – (0,576-3,466)
?2 – 0,57
p = 0,44925
brak istotności statystycznej
Allel ryzyka GG vs. GA + AA: iloraz szans OR = -1,094
C.I. – (0,607-1,970)
?2 – 0,09
p = 0,76530
brak istotności statystycznej
Allel ryzyka AA + AG vs. GG: iloraz szans OR = 1,601
C.I. – (0,708-3,618)
?2 – 1,29
p = 0,25542
brak istotności statystycznej
Dyskusja
Badania nad genetycznym podłożem rozwoju tocznia rumieniowatego układowego prowadzone są od lat. Harley J.B. i wsp. (13) obserwowali rodzinne występowanie choroby i współzależność pojawiających się zmian genetycznych. Udowodnili, że toczeń nie jest chorobą zdeterminowaną przez jedną zmianę w pojedynczym locus. W swoich badaniach zajmowali się położeniem polimorfizmów na wirtualnej mapie ludzkiego genomu. Znajomość dokładnego położenia markerów genetycznych ułatwia zrozumienie złożonego schorzenia jakim jest toczeń rumieniowaty układowy (13). Namjou B. i wsp. (14) prowadzili badania nad dziedzicznymi niedoborami składowej C1q układu dopełniacza, oceniając polimorfizmy występujące w genie kodującym C1q, dotyczące łańcuchów A, B i C. Przebadali 17 pojedynczych nukleotydowych polimorfizmów w populacji Afroamerykanów i Hiszpanów. Analizy ilościowe pokazały, że niektóre pojedyncze nukleotydowe polimorfizmy w genie C1q mogą być powiązane ze stężeniem składowej C3 w surowicy. Udowodnili, że polimorfizmy w genie kodującym C1qA są powiązane z fenotypami tocznia rumieniowatego układowego w tych dwóch badanych populacjach (14). Chew H. i wsp. (15) badali metodą PCR – RFLP pojedyncze nukleotydowe mutacje C1q u malezyjskich pacjentów chorych na toczeń rumieniowaty układowy. Zajmowali się siedmioma typami mutacji w genie kodującym C1q, które są zlokalizowane w: C1qA – Gln186 (C > T), C1qB – Gly15 (G > A), C1qB – Arg150 (C > T), C1qC – Gly6 (G – A), C1qC – Arg41 (C > T) oraz dwoma pojedynczymi nukleotydowymi polimorfizmami: C1qA – Gly70 (G/A), C1qC – Pro14 (T > C). Stwierdzili, że niedobór C1q nie jest głównym czynnikiem genetycznym powodującym TRU w populacji malezyjskiej. Celem naszego badania było określenie częstości występowania polimorfizmu C1q (rs292001) w polskiej populacji chorych na toczeń rumieniowaty układowy. Nie stwierdziliśmy istotnych różnic w częstości występowania badanego polimorfizmu w populacji zdrowych osób w porównaniu do grupy chorych. Częstości występowania poszczególnych polimorfizmów AA, GG oraz AG były podobne w obu badanych grupach. Chew H. i wsp. badali również i nie stwierdzili żadnych związków klinicznych i laboratoryjnych obserwowanych w genotypach i allelach u pacjentów chorych na toczeń rumieniowaty układowy oraz żadnych w przypadku mutacji występujących w C1qA – Gly70 (G/A) i C1qC – Pro14 (T > C) SNPs. Nasze badania również nie potwierdziły istotnych zależności między badanym polimorfizmem C1q (rs292001) a wynikami badań laboratoryjnych.

Martens H.A. i wsp. (9) badając polimorfizmy C1q rs631090 u chorych na toczeń rumieniowaty układowy stwierdzili, że ma on związek z chorobą i stężenie tej składowej w surowicy u chorych na toczeń rumieniowaty układowy maleje. Jednak badana przez nich populacja była mała. W przypadku rs292001 składowej C1q nie stwierdzono związku z stężeniem C1q w surowicy ale okazało się, że polimorfizm ten ma związek z ciężkim przebiegiem choroby (9). W naszych badaniach nie korelowano surowiczego stężenia C1q z występowaniem polimorfizmu w obrębie C1q, gdyż składnik C1q zawarty w surowicy jest zmienny i nie udało sie uzyskać wystarczająco dużej grupy chorych o stałym niezmiennym stężeniu surowiczego C1q. Natomiast w naszym badaniu nie stwierdzono pozytywnych zależności między aktywnością choroby a badanym polimorfizmem. Sontheimer R.P. i wsp. (16) prowadzili badania nad funkcją składowej C1q oraz jej rolą w autoimmunizacyjnym toczniu. Składowa C1q wpływa na immunoregulację. Świadczy o tym fakt, że u więcej niż 90% osób z wrodzonym niedoborem C1q rozwija się wczesna światłowrażliwa postać tocznia rumieniowatego układowego. Badacze udowodnili, że pojedynczy nukleotydowy polimorfizm może być przyczyną subtelnych różnic w ekspresji C1q i tym samym czynnikiem ryzyka rozwoju choroby(16). Berkel A.I. i wsp. (17) prowadzili genetyczne i epidemiologiczne badania dotyczące selektywnych niedoborów C1q w populacji tureckiej, zajmując się głównie polimorfizmem C > T. Przebadano pacjentów z różnych ośrodków i w różnym wieku. Badacze ci stwierdzili, że niedobór C1q może zwiększać ryzyko wystąpienia objawów tocznia rumieniowatego układowego (18). W naszych badaniach przeprowadzonych na populacji polskiej nie znaleziono statystycznie istotnych różnic w rozkładzie genotypów polimorfizmu C1q składowej dopełniacza rs292001 między grupą pacjentów chorych na TRU a grupą kontrolną zdrowych osób.
Wnioski
Brak różnic w częstości występowania polimorfizmu składowej C1q rs292001 między badaną grupą chorych na TRU a grupą kontrolną może świadczyć o braku wpływu tego polimorfizmu na rozwój TRU w polskiej populacji, jak również o dużej różnorodności czynników genetycznych zaangażowanych w patogenezę choroby.

**Badanie finansowane z planu MNiSW: N N402 267836.
Piśmiennictwo
1. Jakóbisiak M, Wańkowicz-Kalińska A: Zjawiska Autoimmunizacyjne. [W:] Gołąb J, Lasek W (red.): Immunologia. Wydawnictwo Naukowe PWN, Warszawa 2008; 376-397.
2. Botto M, Wlaport MJ: C1q, autoimmunity and apoptosis. Immunobiology 2002; 205: 395-406.
3. Walport MJ, Davies KA, Botto M: C1q and systemic lupus erythematosus. Immunobiology 1998; 199: 265-285.
4. Walport MJ: Complement. Second of two parts. N Eng J Med 2001; 12; 344: 1140-1144.
5. Morgan BP, Walport MJ: Complement deficienty and disease. Immunol Today 1991; 12: 301-306.
6. Petry F, Loos M: Common silent mutations in all types of hereditary complement C1q deficiencies. Immunogenetics 2005; 57: 566-571.
7. Sullivan KE, Petri MA, Schmeckpeper BJ et al.: Prevalence of mutation causing C2 deficiency in systemic lupus erythematosus. J Rheumatol 1994; 21: 1128-1133.
8. Reveille JD, Arnett FC, Wilson RW et al.: Null alleles of the fourth component of complement and HLA haplotypes in familial lupus erythematosus. Immunogenetits 1985; 21: 299-311.
9. Martens HA, Zuurman MW, Lange AHM: Analysis of C1q polymorphism suggest association with SLE serum C1q and CH 50 levels and disease severity. Ann Rheum Dis 2009; 68: 715-20.
10. Racila DM, Sontheimer CJ, Sheffield A et al.: Homozygous single nucleotide polymorphism of the complement C1qA gene is associate with decrease levels of C1q in patient with subacute cutaneus lupus erythematosus. Lupus 2003; 12: 124-132.
11. Tan EM, Cohen AS, Fries JF et al.: The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1982; 25(11): 1271-1277.
12. Bombardier C, Gladman DD, Urowitz MB et al.: Derivation of the SLEDAI. A disease activity index for lupus patients. The committee on prognosis studies in SLE. Arthritis Rheum 1992; 35(6): 630-640.
13. Harley JB, Kelly JA, Kaufman KM: Ultraveling the genetics of systemic lupus erythematosus. Springer Semin Immunopathol 2006; 28: 119 -130.
14. Namjou B, Gray-McGuire C, Sestak AL et al.: Evaluation of C1q genomic region in minority racial groups of lupus. Genes Immun 2009; 10: 517-24.
15. Chew H, Chua KH, Lian LH et al.: PCR – RFLP genotyping of C1q mutations and single nukleotide polymorphisms in Malaysian patients with systemic lupus erythematosus. Hum Biol 2008; 80: 83-93.
16. Sontheimer RD, Racila E, Racila DM: C1q: its functions within the innate and adaptive immune responses and its role in lupus autoimmunity. J Invest Dermatol 2005; 125: 14-23.
17. Berkel AI, Birben E, Oner C et al.: Molecular, genetic and epidemiologic studies on selective complete C1q deficienty in Turkey. Immunology 2000; 201: 347-355.
otrzymano: 2012-06-28
zaakceptowano do druku: 2012-08-22

Adres do korespondencji:
*Izabela Korczowska
Zakład Reumatologii i Immunologii Klinicznej Uniwersytet Medyczny w Poznaniu
ul. Przybyszewskiego 39, 60-356 Poznań
tel.: +48 (61) 854-72-10, fax: +48 (61) 854-72-12
e-mail: ikorcz@post.pl

Postępy Nauk Medycznych 12/2012
Strona internetowa czasopisma Postępy Nauk Medycznych