© Borgis - New Medicine 3/1999, s. 66-67
Jarosław Szydłowski1 Ewa Fik2, Michał Grzegorowski1, Anna Goździcka-Józefiak2, Jarosław Antyborzec1, Iwona Steiner1
The incidence of Chlamidia pneumoniae co-infection in children infected with HPV
1 ENT Department, Paediatric Institute of the Karol Marcinkowski University of Medical Sciences in Poznań, Poland
Head of ENT Department: Prof. Michał Grzegorowski, M.D.
2 Department of Molecular Virology, A. Mickiewicz University
Head of Department: Prof. Anna Goździcka-Józefiak
Summary
Little is know about HPV and Ch. pneumoniae co-infection in the upper respiratory tract of healthy children. A group of 49 HPV positive children (from 3 to 6 years old) was laryngologically examined. Smers from noses and throats were studied for the presence of Ch. pneumoniae DNA. PCR was performed as described by Tucker et al. 59.2% of children from the study group were Ch. pneumoniae positive. The presence of Ch. pneumoniae in the respiratory tract in children is relatively common. A significantly higher level of the carrier state exists in the families of active smokers and families. A with low living standard make a considerable contribution to environmental factors in the spread of HPV and Ch. pneumoniae co-infection.
Polecane
książki z księgarni medycznej BORGIS:
Introduction
The mucosa of the upper respiratory tract (URT) in children is a site where various pathogenes are likely to settle (8). Screening examinations have shown high (46.6%) Human papillomavirus (HPV) carrier state in the URT of healthy children. These findings have caused the authors to undertake further studies in a search for other pathogenes co-existing in URT epithelial cells. The chosen organism was Ch. pneumoniae. Chlamidia micro-organisms are a large group of hypokinetic obligatory intracellular parasites related to gram-negative bacteria, formerly classified as viruses (1). It was believed that the Chlamidia genus comprised two species: Ch. trachomatis - responsible for perinatal infections in neonates and children up to the 2nd year of life (2), and Ch. psittaci - a zoogenous pathogen. The third species - Ch. pneumoniae, a recognized causative agent of upper and lower respiratory infections, was identified in 1986 as a TWAR factor and was considered primarily a Ch. psittaci serotype. The species Ch. pneumoniae has been chosen for further studies because of its relationship to epithelial cells, and the non-symptomatic infections it causes. A significant feature of Chlamidia infections is a frequently noticed symbiosis between a host organism and a parasite. This may account for a long-term infection, sometimes for life (4, 5, 7).
Aim of the paper
The aim of the paper was to establish the level of the Ch. pneumoniae carrier state in the URT of healthy children who had formerly been diagnosed as having a non-symptomatic HPV infection. Moreover, the paper aims at establishing the transmission routes of such infections and identifying possible predisposing factors.
Materials and methods
105 children from a Poznan kindergarten entered the study. As revealed by Virological tests showed that 49 (46.7%) were HPV positive (+), and 56 (53.3%) - HPV negative (-). Among 49 non-symptomatic HPV carriers there were 29 girls (53.1%) and 23 boys (46.9%) 3-7 years of age. The average age of the group was 4 years and 5 months. In anamnesis this information was included with the personal data of both the child and its parents, as well as gestational and perinatal risk factors. A history was taken concerning the present health of the child and its susceptibility to viral or bacterial URT diseases. A family history was also taken, with regard to living and environmental conditions. Pharyngeal swabs were taken from HPV positive children for further studies and analysed for the presence of Ch. pneumoniae DNA. DNA from swabs was isolated using proteinase K etching and File phenolysis (3). To identify the DNA sequence of the chosen pathogenes, a PCR technique was applied with specific starters complementary to a sequence coding the genomes of HPV and Ch. pneumoniae (6). PCR reaction products were analised using agar-gel electrophoresis.
Table 1. Starters used in PCR for identification of Ch. pneumoniae. DNA sequence.
| Startes | Amplified region | DNA thread | 5´-3´ sequence | Lenght of product |
| CHT53-1 CHT53-2 | Gene coding proteins of 53 kDa in weight | + - | ATGATCGCGGTTTCTGTTGCCA GAGCGACGTTTTGTTGCATCT | 499 bp |
| FOS4-1 FOS4-2 | Gene coding transcription sub-unit | + - | GATATTGCCACCCTGCTGAA AGACGAAGGAGGACGTGTAA | 470 bp |
Results
29 infected children (59.2%) were identified in the studied group of HPV carriers, the criterion being the presence of Ch. pneumoniae in swabs. Analysis of the historical data did not show any significant correlation between Ch. pneumoniae and HPV infections in children and the course of pregnancy, diseases affecting mothers during pregnancy (also infectious), drug taking or exposure to unfavourable environmental factors in the prenatal period. No relationship was found between the presence of Ch. pneumoniae and HPV in swabs taken from the URT in children and the time and type of delivery, perinatal complications, or low birth weight. Among HPV (+) and Ch. pneumoniae (+) children, 23 (79.3%) are daily exposed to cigarette smoke at home. For HPV (+) and Ch. pneumoniae (-) children the number is 13 (65%). Out of HPV (-) and Ch. pneumoniae (-) children only 25 (44.6%) have smoking parents. It is worth noting that 58.6% of families with HPV (+) and Ch. pneumoniae (+) children described their living conditions as poor or rather poor, while in the group of HPV (-) and Ch. pneumoniae (-) children only 19.6% of families evaluated their living conditions in the same way. In physical examination, dental caries was found in 21 HPV infected children (65.6%) and enlarged submandibular lymph nodes in 6 (18.7%) while HPV (-) children presented lower values of 35.7% and 8, 9% respectively.
Conclusions
1. Ch. pneumoniae and HPV infections of air passages in children occur very commonly. Co-infections of these pathogenes occur in up to 59.2%.
2. Ch. pneumoniae and HPV in kindergarten children may be transmitted by direct contact.
3. A significantly higher level of Ch. pneumoniae and HPV co-infections in families of smokers and those with poor living standards shows a marked impact of environmental factors on spreading the infection.
4. The investigations did not reveal any co-relation between gestational risk factors like mother´s virus infections, drug taking during pregnancy with children´s infections. Time and type of delivery as well as the child´s condition after birth do not determine infection, either.
5. Further studies are required to explain which extra - and intracellular factors are responsible for Ch. pneumoniae and HPV infections in the airways of children.
Polecane
książki z księgarni medycznej BORGIS:
Piśmiennictwo
1. Choroszy-Król I., Ruczkowska J.: Rola Chlamydii w zakażeniach górnych dróg oddechowych. Otolar. Pol., 1997 LI, supl. 24:383. 2. Falck G. et al.: Prevalence of Chlamydia pneumoniae in healthy children and in children with respiratory tract infection. Pediatr. Infect. Dis. J., 1997 Jun., 16, 6:549. 3. Fife K.H. et al.: Symptomatic and asymptomatic cervical infections with human papillomavirus., J. Infect. Dis., 1987, 156:904. 4. Januszkiewicz J.: Zarys kliniki chorób zakaźnych PZWL, Warszawa 1992. 5. Jawetz E. et al.: Przegląd mikrobiologii lekarskiej. PZWL, Warszawa 1991. 6. Kubota B.: A new primer pair for detection Chlamydia pneumoniae by PCR., Microbiol. Immunol.,1997, 40:27. 7. Podsiadły E., Tylewska-Wierzbanowska S.: Chlamydia pneumoniae - biologia i chorobotwórczość, Post Mikrobiol. 1998, XXXVII, 2:145. 8. http://www.brown.edu/Courses/Bio_160/hpv/index.html.

Pozostałe artykuły z numeru 3/1999: