Artykuły w Czytelni Medycznej o SARS-CoV-2/Covid-19

Poniżej zamieściliśmy fragment artykułu. Informacja nt. dostępu do pełnej treści artykułu tutaj
© Borgis - Postępy Nauk Medycznych 1a/2018, s. 4-9 | DOI: 10.25121/PNM.2018.31.1A.4
*Anna Michalska-Bańkowska1, Dominika Wcisło-Dziadecka2, Beniamin Grabarek3, Urszula Mazurek3, Ligia Brzezińska-Wcisło1, Natalia Salwowska1, Piotr Michalski4
Quantitative analysis of transforming growth factor beta isoforms mRNA TGF-β1-3 in the patients with psoriasis
Ilościowa analiza profilu ekspresji mRNA izoform TGF-β1-3 u pacjentów z łuszczycą
1Department of Dermatology, School of Medicine in Katowice, Medical University of Silesia in Katowice
Head of Department: Professor Ligia Brzezińska-Wcisło, MD, PhD
2Department of Skin Structural Studies, School of Pharmacy with the Division of Laboratory Medicine in Sosnowiec, Medical University of Silesia in Katowice
Head of Department: Krzysztof Jasik, assistant professor
3Chair and Department of Molecular Biology, School of Pharmacy with Division of Laboratory Medicine in Sosnowiec, Medical University of Silesia in Katowice
Head of Department: Professor Urszula Mazurek, MD, PhD
4School of Medicine in Katowice, Medical University of Silesia in Katowice
Director of School: Przemysław Jałowiecki, MD, PhD
Streszczenie
Wstęp. Łuszczyca to dermatoza związana ze zmianami stężeń prozapalnych cytokin. Jedną z nich jest transformujący czynnik wzrostu beta (TGF-β), który u człowieka występuje w trzech izoformach (TGF-β1-3). TGF-β charakteryzuje się właściwościami antyproliferacyjnymi w odniesieniu do keratynocytów naskórka. Duże rozpowszechnienie, uciążliwość objawów oraz fakt, że zmiany molekularne wyprzedzają zmiany fenotypowe skłaniają do szukania nowych markerów molekularnych.
Cel pracy. Celem pracy była ocena zmian profilu ekspresji genów kodujących izoformy TGF-β1-3 u osób chorujących na łuszczycę w porównaniu z osobami zdrowymi oraz wskazanie możliwości wykorzystania tej cytokiny jako nowego uzupełniającego markera molekularnego.
Materiał i metody. Grupę badaną stanowiły 32 osoby chorujące na łuszczycę, a grupę kontrolną 20 zdrowych ochotników. Od wszystkich osób pobrano pełną krew, z której ekstrahowano całkowity RNA, stanowiący matrycę w reakcji RTqPCR.
Wyniki. Statystycznie istotne różnice ekspresji między badanymi grupami określano testem U Manna-Whitneya (p < 0,05): dla TGF-β1 p = 0,00005; TGF-β2 p = 0,007; TGF-β3 p = 0,007. U osób zdrowych i chorych na łuszczycę stwierdzono występowanie wszystkich trzech izoform TGF-β (TGF-β1 > TGF-β3 > TGF-β2).
Wnioski. Uzyskane wyniki wskazują, że oznaczanie ekspresji TGF-β1-3 może być użytecznym, nowym markerem molekularnym w łuszczycy, wkomponowując się w strategię personalizacji leczenia. Można stwierdzić, iż tego typu oznaczenie nie byłoby zbyt obciążające i kłopotliwe z punktu widzenia pacjenta.
Summary
Introduction. Psoriasis is a dermatosis connected with changes in the concentrations of pro-inflammatory cytokines. One of them is a beta transforming growth factor (TGF-β), which appears in three isoforms in humans (TGF-β1-3). TGF-β has antiproliferative properties towards keratinocytes of epidermis. Great disease spread, arduousness of its symptoms and the fact that molecular changes precede phenotypic changes make us looking for new molecular markers.
Aim. The aim of the paper was to evaluate of changes in the expressions of genes encoding TGF-β1-3 isoforms in psoriatic patients when compared with healthy persons and indicate possibilities to use the cytokine as a new complementary molecular marker.
Material and methods. The group was composed of 32 psoriatic patients, and the control group consisted of 20 of healthy volunteers. All persons were taken their whole blood, form which total RNA was extracted that constituted the matrix in RTqPCR reaction.
Results. Statistically significant differences of expressions were determined between the evaluated groups with the use of the Mann-Whitney U test (p < 0.05): for TGF-β1 p = 0.00005; TGF-β2 p = 0.007; TGF-β3 p = 0.007. All three isoforms TGF-β (TGF-β1 > TGF-β3 > TGF-β2) were detected in both healthy persons and psoriatic patients.
Conclusions. The achieved results indicate that determination of TGF-β1-3 expression may become a useful, new molecular marker in psoriasis, integrating into the strategy of treatment personalisation. It may be stated that such determination would not be very burdensome or troublesome from the patient’s point of view.
Słowa kluczowe: łuszczyca, TGF-β, marker molekularny.
Introduction
Psoriasis is a chronic, immunologic, multi-factor pro-inflammatory skin disorder found worldwide in 1-3% population (1-3). Two main age groups among psoriatic patients may be identified: 20-30 years of age and 50-60 years of age. In clinical terms, psoriasis involves papular lesions on erythematous background, coated with white silvery scale, localised on the hairy areas of the head and covering symmetrically the extensory parts of the upper and lower limbs, as well as the lumbo-sacral area. The dermatosis occurs in the following varieties: psoriasis vulgaris (90% of all cases), palmoplantar pustular psoriasis, general psoriasis pustulosa, psoriasis unguium, erythrodermic psoriasis and psoriatic arthritis (2).
The characteristic feature in psoriasis is parakeratosis, i.e. approximately 8-times accelerated partial keratosis, triggered with distorted proliferation and keratinocyte differentiation in the basal layer of the skin. Moreover, changes in the cytokine secretion profile, incorrect proliferation and differentiation of epidermal cells, as well as intensified angiogenesis (1, 4-6).
One of the cytokines that plays a significant role in the dermatosis is a beta transforming growth factor (TGF-β), which appears in three isoforms in mammals: TGF-β1 is mainly located in stratum corneum and stratum granulosum of the skin, TGF-β2 in stratum spinosum and TGF-β3 was detected in the basal layer and below (6). It plays a key role in many physiological and pathological processes (7). The beta transforming growth factor shows ant-proliferative properties towards keratinocytes in epidermis (8), it can inhibit the cycle in the epithelial cells of such organs, like, for instance: lungs, liver, spleen, prostate, ovaries and epidermal cells, as well as in the progenitor blood cells – lymphatic and hematopoietic cells (9).
TGF-β1 is the isoform of the said cytokine that was the most characterised and described. It acts as a strong inhibitor of cell proliferation, since it stops the G1 phase of the cellular cycle and stimulates directly formation of new blood vessels (10).
TGF-β1 is synthesized in the progenitor form and as a result of maturity an inactive complex is formed: matured TGF-β1 – LAP (11, 12), which is released form the extracellular matrix. Proteases take part in the removal process of TGF-β1 during the latent cycle (4) and activation occurs extracellularly, when TGF-β1 is released from the complex (11, 13). Molecular form of TGF-β begins to activate on the cell surface, when the soluble peptide TGF-β binds with TGFβRII receptor, an active serine-threonine kinase, which – in turn – leads to the recruitment and phosphorylation of TGF-β RI. TGF-β then transmits the signal inside the cell through the phosphorylation of proteins: Smad2 and Smad3. Then the proteins form a complex with Smad4, which gather inside the nucleus and act as transcription agents (1, 14).
Aim
The aim of this paper is to determine the transcription activity of genes encoding isoforms of the beta transforming growth factor TGF-β1-3 in psoriatic patients when compared with healthy persons (constituting the control group), and thus to assess the possibilities to make use of the changes in the expression profiles of the tested isoforms as the complementary molecular markers in the diagnostic and treatment of psoriasis.
Material and methods
The study was conducted with the agreement of the Committee of Bioethics in Katowice – Resolution No. KNW/0022/KB1/59/I/13/14 of 27.05.2014.
The first stage involved qualification of persons to the sample and control groups, basing on the inclusion and exclusion criteria, included in tables 1 and 2, respectively.
Tab. 1. Criteria of inclusion to and exclusion from the study group
Criteria of inclusion to the study groupCriteria of exclusion from the study group
patient’s voluntary informed consent to participate in the study no patient’s voluntary informed consent to participate in the study
moderate, severe form of psoriasis (PASI > 10, DLQI > 10, BSA > 10)mild form of psoriasis, to be treated in an outpatient’s mode or with the use of a photo therapy
age 30-60 yearsage below 30 or over 60 years
normal results of laboratory tests showing preserved kidney function (creatinine within the scope of reference values)uncontrolled high arterial hypertension or no therapeutic effect, pressure charges, renal failure
preserved 3-month period during which the patient did not use general corticosteroid therapy or immunosuppressive medicinesimmunosuppressive therapy or general corticosteroid therapy during the study or during the last 3 months preceding the study
negative history of a current or past tumour current tumour, lymphoproliferative disorders
no detected lymphoproliferative disorders (normal blood cell count results)serious inflammatory diseases – rheumatoid arthritis and systemic lupus erythematosus, presence of such diseases, like Marfan syndrome, muscular dystrophy, sarcopenia, immediate post-operative conditions, skeletal muscle injuries
Tab. 2. Criteria of inclusion to and exclusion from the control group
Criteria of inclusion to the control groupCriteria of exclusion from the control group
volunteer’s voluntary informed consent to participate in the study no volunteer’s voluntary informed consent to participate in the study
no diagnosed psoriasis or other skin diseasescurrent immunosuppressive therapy for any reason or general corticosteroid therapy during the study or during the last three months
age 30-60 yearsage below 30 or over 60 years
preserved 3-month period, at least, during which the volunteer did not use general corticosteroid therapy or immunosuppressive therapy for any reasonserious inflammatory diseases – rheumatoid arthritis and systemic lupus erythematosus and immediate post-operative conditions, skeletal muscle injuries
The sample group was composed of 32 patients (20 men and 12 women), who gave their informed consent to participate in the study, aged 53.9 ± 10.4, with diagnosed psoriasis. These persons were hospitalised at the Dermatology Ward and treated in the Outpatient’s Dermatology Clinic.
In turn, the control group consisted of 20 healthy volunteers, who did not have psoriasis and who did not use corticosteroids, for any reasons, during 3 months preceding the study (9 women, 11 men) aged 46 ± 10. The material for study was 5 ml of whole blood taken from persons qualified to the sample and control groups.
The first stage of the molecular analysis involved isolation of total RNA from the whole blood with the use of FENOZOL reagent (A & A Biotechnology, Gdańsk, Poland), according to the guidelines included in the protocol. Extracts of nucleic acid were then assessed in quantitative terms through electrophoresis in 0.8% agarose gel in qualitative terms through spectrophotometry (GeneQuant II, Pharmacia Biotech).
The next stage of the molecular analysis involved qualitative amplification reaction with reverse transcription (RTqPCR) for mRNA for the following genes: TGF-β1, TGF-β2, TGF-β3 in the presence of β-actin (ACTB) and GAPDH to control endogenous reactions. Table 3 presents the sequence of used starters. The analysis was conducted with the use of Opticon™ DNA Engine Sequence Detector (MJ Research Inc., Watertown, MA, USA) with the use of reagent set – SYBR Green Quantitect RT-PCR Kit (Qiagen, Valencia, CA, USA). Thermal conditions for the conducted reaction were as follows: reverse transcription (RT) reaction was conducted in the temperature of 50°C for 30 minutes, amplification was conducted in the following temperatures: 95°C for 15 minutes; 42 two-stage cycles: 94°C for 30 second and 60°C for 60 seconds and final extension: 72°C for 30 seconds. The specificity of RTqPCR reactions was assessed through division of amplimers in 6% and determination of the reaction product melting temperature.
Tab. 3. Stater sequences used in qRT-PCR reaction
mRNAOligonucleotide sequence
TGF-β1Forward: 5’TGAACCGGCCTTTCCTGCTTCTCATG3’
Reverse: 5’GCGGAAGTCAATGTACAGCTGCCGC3’
TGF-β2Forward: 5’TACTACGCCAAGGAGGTTTACAAA3’
Reverse: 5’TTGTTCAGGCACTCTGGCTTT3’
TGF-β3Forward: 5’CTGGATTGTGGTTCCATGCA3’
Reverse: 5’TCCCCGAATGCCTCACAT3’
GAPDHForward: 5’-GAAGGTGAAGGTCGGAGTC-3’
Reverse: 5’-GAAGATGGTGATGGGATTC-3’
ACTBForward: 5’-TCACCCACACTGTGCCCATCTACGA-3’
Reverse: 5’-caGcGGaaccGctcattGccaatGG-3’
forward – forward primer, reverse – reverse primer
Results

Powyżej zamieściliśmy fragment artykułu, do którego możesz uzyskać pełny dostęp.

Płatny dostęp tylko do jednego, POWYŻSZEGO artykułu w Czytelni Medycznej
(uzyskany kod musi być wprowadzony na stronie artykułu, do którego został wykupiony)

Aby uzyskać płatny dostęp do pełnej treści powyższego artykułu, należy wprowadzić kod:

Kod (cena 19 zł za 7 dni dostępu) mogą Państwo uzyskać, przechodząc na tę stronę.
Wprowadzając kod, akceptują Państwo treść Regulaminu oraz potwierdzają zapoznanie się z nim.

 

 

Płatny dostęp do wszystkich zasobów Czytelni Medycznej

Aby uzyskać płatny dostęp do pełnej treści powyższego artykułu oraz WSZYSTKICH około 7000 artykułów Czytelni, należy wprowadzić kod:

Kod (cena 49 zł za 30 dni dostępu) mogą Państwo uzyskać, przechodząc na tę stronę.
Wprowadzając kod, akceptują Państwo treść Regulaminu oraz potwierdzają zapoznanie się z nim.

Piśmiennictwo
1. Litvinov IV, Bizet AA, Binamer Y et al.: CD109 release from the cell surface in human keratinocytes regulates TGF-β receptor expression, TGF-β signalling and STAT3 activation: relevance to psoriasis. Exp Dermatol 2011; 20(8): 627-632.
2. Wang H, Peters T, Sindrilaru A et al.: TGF-beta-dependent suppressive function of Tregs requires wild-type levels of CD18 in a mouse model of psoriasis. J Clin Invest 2008; 118(7): 2629-2639.
3. Szepietowski J, Adamski Z, Chodorowska G et al.: Leczenie łuszczycy – rekomendacje ekspertów Polskiego Towarzystwa Dermatologicznego. Część II: Łuszczyca umiarkowana do ciężkiej. Przegl Dermatol 2014; 101: 455-472.
4. Michaelis K, Wallbrecht K, Kerstan A et al.: Modulating T cell functions does not alleviate chronic inflammatory skin lesions in K5.TGF beta 1 transgenic mice. Exp Dermatol 2010; 19(5): 406-415.
5. Baroni A, Paoletti I, Ruocco E et al.: Possible role of Malassezia furfur in psoriasis: modulation of TGF-beta1, integrin, and HSP70 expression in human keratinocytes and in the skin of psoriasis-affected patients. J Cutan Pathol 2004; 34(1): 35-42.
6. Michalak-Stoma A, Bartosińska J, Chodorowska G et al.: Serum levels of selected Th17 and Th22 cytokines in psoriatic patients. Dis Markers 2013; 35(6): 625-631.
7. Kajdaniuk D, Marek B, Borgiel-Marek H, Kos-Kudła B: Transforming growth factor β1 (TGF-β1) in physiology and pathology. Endokrynol Pol 2013; 64(5): 384-396.
8. Zhang Y, Meng XM, Huang XR et al.: Transforming growth factor-β1 mediates psoriasis-like lesions via a Smad3-dependent mechanism in mice. Clin Exp Pharmacol Physiol 2014; 41(11): 921-932.
9. Stalińska L, Ferenc T: The role of TGF-β in cell cycle regulation. Post Hig Med Dosw 2005; 59: 441-449.
10. Zaher H, Shaker OG, El-Komy MH et al.: Serum and tissue expression of transforming growth factor beta 1 in psoriasis. J Eur Acad Dermatol Venereol 2009; 23(4): 406-409.
11. Burks TN, Cohn RD: Role of TGF-β signaling in inherited and acquired myopathies. Skelet Muscle 2011; 1(1): 19.
12. Biernacka A, Dobaczewski M, Frangogiannis NG: TGF-β signaling in fibrosis. Growth Factors 2011; 29(5): 196-202.
13. Mokrosiński J, Krajewska WM: TGF beta signalling accessory receptors. Postepy Biochem 2008; 54(3): 264-273.
14. Finnson KW, Tam BY, Liu K et al.: Identification of CD109 as part of the TGF-beta receptor system in human keratinocytes. FASEB J 2006; 20(9): 1525-1527.
15. Wu WZ, Zhang FR: Glycyrrhizin combined with acitretin improve clinical symptom of psoriasis via reducing Th17 cell differentiation and related serum cytokine concentrations. Int J Clin Exp Med 2011; 8(9): 16266-16272.
16. Boniface K, Bernard FX, Garcia M et al.: IL-22 inhibits epidermal differentiation and induces proinflammatory gene expression and migration of human keratinocytes. J Immunol 2005; 174: 3695-3702.
17. Kurzeja M, Rudnicka L, Olszewska M: New interleukin-23 pathway inhibitors in dermatology: ustekinumab, briakinumab, and secukinumab. Am J Clin Dermatol 2011; 12(2): 113-125.
18. Gubán B, Vas K, Balog Z et al.: Abnormal regulation of fibronectin production by fibroblasts in psoriasis. Br J Dermatol 2016; 174(3): 533-541.
19. Arora N, Shah K, Pandey-Rai S: Inhibition of imiquimod-induced psoriasis-like dermatitis in mice by herbal extracts from some Indian medicinal plants. Protoplasma 2016; 253(2): 503-515.
20. Feng AP, He YM, Liu XX et al.: Expression of USP15, TβR-I and Smad7 in psoriasis. J Huazhong Univ Sci Technolog Med Sci 2014; 34(3): 415-419.
21. Michalak-Stoma A, Pietrzak A, Szepietowski J C et al.: Cytokine network in psoriasis revisited. Eur Cytokine Netw 2011; 22(4): 160-168.
22. Pietrzak AT, Zalewska A, Chodorowska G et al.: Cytokines and anticytokines in psoriasis. Clin Chim Acta 2008; 394(1-2): 7-21.
23. Pietrzak A, Zalewska A, Chodorowska G et al.: Genes and structure of selected cytokines involved in pathogenesis of psoriasis. Folia Histochem Cytobiol 2008; 46(1): 11-21.
24. Liu XX, Feng AP, He YM et al.: Association of down-regulation of CD109 expression with up-expression of Smad7 in pathogenesis of psoriasis. J Huazhong Univ Sci Technolog Med Sci 2016; 36(1): 132-136.
25. Micali G, Lacarrubba F, Musumeci ML et al.: Cutaneous vascular patterns in psoriasis. Int J Dermatol 2010; 49(3): 249-256.
26. Yue J, Mulder KM: Transforming growth factor-beta signal transduction in epithelial cells. Pharmacol Ther 2001; 91(1): 1-34.
27. Liu R, Wang Y, Zhao X et al.: Lymphocyte inhibition is compromised in mesenchymal stem cells from psoriatic skin. Eur J Dermatol 2014; 24(5): 560-567.
28. Meki AR, Al-Shobaili H: Serum vascular endothelial growth factor, transforming growth factor β1, and nitric oxide levels in patients with psoriasis vulgaris: their correlation to disease severity. J Clin Lab Anal 2014; 28(6): 496-501.
29. Trowbridge RM, Pittelkow MR: Epigenetics in the pathogenesis and pathophysiology of psoriasis vulgaris. J Drugs Dermatol 2014; 13(2): 111-118.
30. Fan X, Yang S, Huang W et al.: Genetics Fine Mapping of the Psoriasis Susceptibility Locus PSORS1 Supports HLA-C as the Susceptibility Gene in the Han Chinese Population. PLoS Genet 2008; 4(3): e1000038. DOI: 10.1371/journal.pgen.1000038.
31. Doi H, Shibata MA, Kiyokane K, Otsuki Y: Downregulation of TGFbeta isoforms and their receptors contributes to keratinocyte hyperproliferation in psoriasis vulgaris. J Dermatol Sci 2003; 33(1): 7-16.
otrzymano: 2018-02-06
zaakceptowano do druku: 2018-02-27

Adres do korespondencji:
*Anna Michalska-Bańkowska
Katedra i Klinika Dermatologii
Śląski Uniwersytet Medyczny w Katowicach
ul. Francuska 20/24, 40-027 Katowice
tel./fax +48 (32) 256-11-82
kikderm@sum.edu.pl

Postępy Nauk Medycznych 1a/2018
Strona internetowa czasopisma Postępy Nauk Medycznych